The C. elegans ORF-RNAi Library includes clones containing full open reading frames for over 11,000 genes, ready for your RNAi screens! These clones are derived from the C. elegans ORFeome Library v1.1.
- Full Coding Regions: From Start-to-Stop, the entire open reading frame is cloned into an RNAi feeding vector and compatible host.
- Feeding Ready: The cloned ORFs have been transformed into the RNAi feeding bacterial strain HT115(DE3)2 and the feeding vector, PL4440.
- RNAi Versatility: Plasmid preps of the ORF-RNAi clones can be used as templates for in vitro dsRNA synthesis for soaking or injection
Methods and Applications
The C. elegans ORF-RNAi Feeding Library v1.1 clones each target a single gene, and includes 1,736 C. elegans genes not targeted previously by any RNAi-by-feeding clones. Cloned Open Reading Frames (ORF) provide an alternative to the genomic DNA fragments previously described and as ORFs are free of introns, they provide more template for in vivo siRNA production. The C. elegans ORFeome-RNAi v1.1 library represent ~55% of the predicted genes with 11,804 RNAi clones comprising the C. elegans ORF-RNAi Feeding Library. High throughput-recombinational cloning protocols were used to transfer the C. elegans ORFeome v1.1 into the pL4440-dest-RNAi feeding vector using recombinational cloning methods.
The following pairs of universal primers can be used for PCR amplification and sequencing:
pL4440-dest-RNAi-FOR (5' GTTTTCCCAGTCACGACGTT 3')
pL4440-dest-RNAi-REV (5'TGGATAACCGTATTACCGCC 3')
The C. elegans ORFeome clones that have been transferred into the RNAi feeding vector have been end sequence verified (Reboul 2003). A sampling of 100 RNAi clones have been randomly picked and sequenced. 96% of the RNAi clones contained the expected sequence. It is strongly suggested you to sequence your clones prior to an experiment if you use less than 100 RNAi clones. If you perform a genome scale analysis, we suggest you to sequence verify your “hits” after the RNAi screening.
Individual clones:
Clones are provided as a live culture in a 2ml tube. Each tube contains LB medium supplemented with 8% glycerol and the appropriate antibiotic. We will ship your clone at room temperature via express delivery. Store the stock clone at -80°C.
Bulk orders and Entire Collection:
Orders for 50 clones or greater and the entire C. elegans ORF-RNAi collection are provided in microtiter plates. These will ship on dry-ice via overnight delivery and should be stored at -80°C immediately upon receipt. Please contact our customer service department for estimated shipping time on orders for the entire collection.